Journal: Nature Communications

Article Title: A pan-CRISPR analysis of mammalian cell specificity identifies ultra-compact sgRNA subsets for genome-scale experiments

doi: 10.1038/s41467-022-28045-w

Figure Lengend Snippet: a Schematic illustrating difference between classic synthetic lethality and our common genetic architecture . Synthetic lethality consists of many individual Y i functions. These functions are cell-type-specific models with single features. Our proposed common genetic architecture is hypothesized to connect these “private” functions with shared CERES features. A common genetic architecture has many redundant edges, and more interconnected nodes. More nodes suggest that more cell-type-specific phenotypes are predictable, and more edges suggest redundancy. b A network built from the aggregation of all multivariate models. Genes are represented as nodes and feature-target gene relations as edges. Colors represent distinct subnetwork communities that were identified by the Louvain method. c Network communities with (right) and without (left) nodes/edges involving functional CRISPR features for a single Louvain community, and a comparison with our hypothesis from ( a ). Edges are colored based upon the data source; and nodes are colored based on the model score (of top ten feature model) of the corresponding gene as target. d To quantitate the visual similarity between our hypothesis in ( a ) and the data in ( c ) across all Louvain communities, we examined the differences in the clustering coefficient, the average number of neighbors, and the network heterogeneity. e gprofiler2 plots examine the enrichment of functional categories. f Residual plot identifies GO terms that are more (residuals of −log10 P values >10) or less (residuals of -log10 P values < −10) enriched in predictor genes than in target genes. Dots represent shared GO terms among the 100 most significant terms in target and predictor gprofiler2 analysis result. The p- values from gprofiler2 for ( e ) and ( f ) are based on hypergeometric tests with multiple testing corrections using the g:SCS method. Source data are provided as a Source Data file.

Article Snippet: Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178).

Techniques: Functional Assay, CRISPR, Comparison

Journal: Nature Communications

Article Title: A pan-CRISPR analysis of mammalian cell specificity identifies ultra-compact sgRNA subsets for genome-scale experiments

doi: 10.1038/s41467-022-28045-w

Figure Lengend Snippet: a Two separate pooled screens were performed in a cell line (PC9) that was not included in model training and validation. Experiment 1 was the full Brunello library. A 21-day dropout experiment was performed in PC9 cells. Measurements on 18,114 genes were direct and form the gold standard. The L200 can be computationally extracted from the full screen and compared to these gold-standard measurements. A new L200 standalone library of 800 guides targeting 200 genes was cloned. This library can be used to perform a small-scale lossy compression experiment. The data can then be compared to the gold standard. b Correlations of inferred vs measured CERES scores for both screens in ( a ) and a comparison of the predictions between the standalone sets and the computationally extracted L200 set in the Brunello library. c A Venn diagram describes the overlap in “Hits” in the 500 most differentially required genes for growth in PC9 cells. Both of the lossy compression screens from ( a ) and the gold-standard (measured) data are compared. Source data are provided as a Source Data file.

Article Snippet: Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178).

Techniques: Biomarker Discovery, Clone Assay, Comparison

Journal: Cell

Article Title: Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis

doi: 10.1016/j.cell.2015.02.038

Figure Lengend Snippet: (A) Schematic representation of the loss-of-function metastasis screen using the mouse genome-scale CRISPR/Cas9 knock-out library (mGeCKOa).

Article Snippet: Pooled guide-only library cloning and viral production The Cas9-GFP KPD cell line was transduced at a MOI of ~ 0.4 with a genome-wide lentiviral mouse CRISPR knockout guide-only library ( Sanjana et al., 2014 ) containing 67,405 sgRNAs (mGeCKOa, Addgene 1000000053) with at least 400-fold representation (cells per construct) in each infection replicate.

Techniques: CRISPR, Knock-Out

Journal: Cell

Article Title: Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis

doi: 10.1016/j.cell.2015.02.038

Figure Lengend Snippet: (A) Schematic representation of lentiviral transduction of Cas9-GFP KPD cells with single sgRNAs designed to target one gene or miR. After puromycin selection, the cell population was transplanted into Nu/Nu mice and also deep sequenced to examine the distribution of indels at the target site. After 5 weeks, the primary tumor and lungs are examined.

Article Snippet: Pooled guide-only library cloning and viral production The Cas9-GFP KPD cell line was transduced at a MOI of ~ 0.4 with a genome-wide lentiviral mouse CRISPR knockout guide-only library ( Sanjana et al., 2014 ) containing 67,405 sgRNAs (mGeCKOa, Addgene 1000000053) with at least 400-fold representation (cells per construct) in each infection replicate.

Techniques: Transduction, Selection

Journal: Cell reports

Article Title: MCK2-mediated MCMV infection of macrophages and virus dissemination to the salivary gland depends on MHC class I molecules.

doi: 10.1016/j.celrep.2023.112597

Figure Lengend Snippet: Figure 2. Neuropilin 1 (Nrp1) and CX3CR1 do not mediate MCK2-dependent MCMV infection of macrophages (A) Representative flow cytometry histograms plots of Nrp1 levels on NIH/3T3 fibroblasts or RAW 264.7 monocyte/macrophage cells without nucleofection or nucleofected with CRISPR-Cas9 ribonucleoparticles targeting Nrp1 (Nrp1 RNPs). (B) Quantification of mCherry signal at 20 hpi with indicated MCMV strains at MOI of 1 from cells treated with control (Ctrl.) RNPs or Nrp1 RNPs. (C) Representative flow cytometry histograms plots of CX3CR1 levels on NIH/3T3 fibroblasts or RAW 264.7 monocyte/macrophage cells that were nucleofected with Ctrl. or CX3CR1 RNPs. (D) Quantification of mCherry signal at 20 hpi with MCMV-3DR at MOI of 1 from cells treated with Ctrl. RNPs or CX3CR1 RNPs. (E) Quantification of mCherry signal at 20 hpi with MCMV-3D or -3DR at MOI of 1 from alveolar macrophages collected by bronchoalveolar lavage from wild-type (WT) or Cx3cr1/ mice. (B and D) Data are from 3–4 independent experiments. One dot equals a mean of the triplicates from one experiment, line at mean value per group. (E) Data are from 2 experiments with 5–6 animals per group (dots), and line represents mean value per group. (C–E) Statistical analysis: one-way ANOVA test followed by Sidak’s multiple comparison test; ns, not significant; **p < 0.01, ***p < 0.001, ****p < 0.0001.

Article Snippet: Next, SpCas9-expressing Nrp1 / NIH/3T3 fibroblasts were then transduced with the Mouse Brie CRISPR knockout lentiviral prep (Addgene #73633-LV) as described previously.48,49 Next, two biological replicates of cells expressing mouse Brie library were infected with MCK2+ MCMV-3DR at MOI 10.

Techniques: Infection, Cytometry, CRISPR, Control, Comparison

Journal: Cell reports

Article Title: Upregulation of exosome secretion from tumor-associated macrophages plays a key role in the suppression of anti-tumor immunity.

doi: 10.1016/j.celrep.2023.113224

Figure Lengend Snippet: Figure 7. Targeting Rab27a by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).

Article Snippet: Murine TNF-a: 50-GGTGCCTATGTCTCAGCCTCTT-30 and 50-GCCATAGAA CTGA TGAGAGGGAG-3’; Murine IL-1b: 50- TGGACCTTCCAGGATGAGGACA-3’; Murine IL-6: 50-T ACCACTTCACAAGTCG GAGGC-30 and 50- CTGCAAGTGCATCA TCGTTG TTC-3’; TGF-b: 50-TGATACGCCTGAGTGGCTGTCT-3’; GAPDH: 50-CATCACT GCCACC CAGAAGACTG-30 and 50-ATGCCAGTGAGCTTCCCGTTCAG-3’. shRNA knockdown and CRISPR-Cas9 knockout shRNAs against human RAB27A (NM_004850, GCTGCCAATGGGACAAACATA, CAGGAGAGGTTTCGTAGCTA),96 mouse RAB27A (NM_001301230.1, CGAAACTGGATAA GCCAGCTA, GACAAACATAAGCCACGCGAT), human MADD (NG_029462.1, CCACAAGT ACAAGACGCCAAT, CCTGAAAGTATTTGGGCTAAA), mouse MADD (NM_001177720.1, CCACAAGTACAAGACGCCAAT, CCGCTCATTTATGGCAATGAT) or scrambled shRNA (Addgene, Catalog Number:1864) were co-transfected with viral packaging plasmids to package lentiviral particles using HEK293T cells.

Techniques: Expressing, Clinical Proteomics